Find kmers in one gene:

• Input the kmers:




• Provide a gene flanking sequence or genename:

 Find the kmer in customized sequences : 

Customized sequences    


Please input the flanking sequences of one gene in fasta format from the species as follows:

>mygene
ATCGATCGATCGATCGATCGGGCCCATTATTTTGGGGG






 Or, find the kmers in provided gene name of flanking sequences from these species : 

A. thaliana     O. sativa    

Input the gene name. Please confirm that the gene name matches to the sequence name in selected species, such as AT1G01010 for Arabidopsis and Os01g0100100 for Rice.